Human Variation and Race: High Altitude

High altitude can be very dangerous for people who have not been exposed to that type of environment by their ancestors or for many years.  High altitude causes hypoxia in many people because of the lack of oxygen one is able to intake.  As the altitude rises, the air pressure decreases which makes it hard to breath at higher altitudes.  Hypoxia is one negative factor that this environmental stress can have on people, but it is possible to acclimatize to the environment physiologically.

A short-term adaptation to high altitude would be "high altitude sickness".  This is a short-term adaptation because the sickness eventually goes away, once the body has made it's self more acclimated.  The symptoms do not come back when the person who suffers "high altitude sickness" returns to their normal environment.

One facultative adaptation of high altitude is enhanced fitness.  This adaptation is considered facultative because the body becomes physically acclimated to the diminished air pressure through the genes which changes their hemoglobin level and provides them with normal fitness level at high altitude.  This normal fitness level at high altitude is due to enhanced oxygen in the blood stream created by the raised hemoglobin giving the person enhanced-fitness when they return to their normal environment.

Developmental adaptation is one that effects a gene in a persons DNA because the stressor has caused such a great impact one generation after generation it has become apart of the gene pool.  For example in high altitude, or those with ancestors who are from high altitudes will have very rosy cheeks because they can create more hemoglobin due to a change in their DNA.  The higher amount of hemoglobin changes the phenotype they present.  Due to the lack of air pressure and oxygen at high altitudes, people's hemoglobin level will rise trying to create more oxygen for that person which will cause their cheeks to be red resulting in a developmental change over quite a long period.

Cultural adaptation is very important in all types of environmental stressors.  One interesting cultural adaption to high altitude is the chanting and deep breathing of Buddhist monks.  The chanting and deep breathing helped the Nepalese increase oxygen flow to decrease the risk of hypoxia.

The main benefit of studying human variation from this prespective is realizing that race does not exist.  Humans are all made of the somethings whether it is believed to be true or not, the only variation there is are the type of phenotypes that one presents.  Information from explorations like this can be helpful to the continuation of the theory of evolution as well as to helping American culture be more accepting of others.  This exploration shows that there is truly no race or difference between the make up of humans, it shows that environmental changes are the reason for different pigments in skin color.  Like the high mountain valley indians and their "red" skin, it is caused by their environmental stressors.

Personally, I would not use race to understand the adaptations I explained.  Race has nothing to do with how a persons body adapts to an environment or stressors in that environment.  Race is a made up term in the United States that has caused hostility between all peoples for absolutely no reason.  The term "race" just goes to show how ignorant the founding fathers of the United States were because skin color is a genetic adaptation, it is not WHO a person is.  The study of environmental stressors and adaptations is a beautiful way to learn more about why and how there is variation among skin color around the world because it gives a person a chance to have an open scientific view which will result in them having an open heart and not believing in "race".

Piltdown Hoax

The “Piltdown Hoax” was great phenomenon for over 40 years.  It all begin one day during the early 1900s at Barkham Manor in Piltdown, England.  A laborer was digging and came upon a strange piece of skull, shocked by his findings he gave the piece of skull to a man named Charles Dawson who was an amateur archaeologist.  To Dawson the skull appeared “thick and primitive” which could have meant great things for the people of England.  During that time Germany and other parts of Europe were finding pieces of bone for creatures that were the earliest humans that they called Neanderthals, and when the laborer found this piece of Skull England was not the only one without early humans anymore.  Britain was constantly trying to prove themselves to be the best and with this new discovery and because of Charles Dawson’s interpretation, they believed they were the birth place for the very first human.  Charles Dawson did not release his interpretation to the public immediately after he had received the piece of skull, he did further digging and research with a man named Sir Arthur Smith Woodward.  They found a jaw bone that looked like the shape of an Ape’s with teeth of a human while they were on their journey.  Between the skull and the jawbone, Sir Arthur Smith Woodward and Charles Dawson came to announce the very first human, the “Piltdown Man”(“the earliest English man”).  The discovery of the “Piltdown Man” enthralled everyone who believed in science and was placed in the Natural History Museum.  In 1953, 40 years after the announcement of the “Piltdown Man”, it was deemed fake by Kenneth Oakley, who worked in the museum.  

Kenneth Oakley used a a type of relative dating known as fluorine analysis to prove that the “Piltdown Man” was, in fact, a hoax.  Oakley deemed that the jaw was more than likely that of an orangutan’s and the teeth were filed to look like a human’s.  Both the skull and the jaw bone were stained to look as if they had been aged.  In conclusion, all of the findings in Piltdown, England had been planned and planted so England could, once again, seem better than the rest.  Each scientist involved with the hoax had serious harm to their lives.  Dawson, the amateur archaeologist, faced all of society making claims towards all of his discoveries.  The writer of Sherlock Holmes, Conan Doyle was not even known as a doctor, and everyone felt that he could have planted the pieces because of his writings.  For society in general, the main question in science was raised once again and at an even greater concern, “who are we? where did we come from?”

Everyone, no matter who you are, has human faults.  Dawson, Doyle, and Sir Arthur were  extremely curious and persistent by nature, obviously, and they wanted to discover the very first human being.  During the early 1900s, England was the only European country that had zero findings of Neanderthal remains and because of all the uproar with the Orthodox church something needed to happen.  They wanted to keep England’s reputation of being the best and felt the only way of doing so was to create the “Piltdown Man”.  The negative human faults that affected these scientists so greatly was greed and lying.

I believe that it is completely possible to remove the  “human” factor from science.  Science is suppose to be factual, testable findings.  Majority of the time it is.  My employer always reminds my coworkers and I that our personal lives are left at the door when we walk in.  When scientists are doing research or want to prove a finding, they should also leave their personal wants and lives behind them for sake of accuracy and honesty.

The “Piltdown Man” has taught me that nothing is ever real or true until further research or investigation is done.  You never want to believe anything from an unknown source, which is hard to do sometimes because of the Internet and the news.

Homologous and Analogous Traits

Homologous Traits
There are so many different species scattered across the universe that have homologous traits.  Homologous traits are those that are "shared between two different species because their common ancestor possessed the trait and passed it on."(Introduction to Physical Anthropology)  After looking at the many different phylogenic charts that are spread out between the internet, the modules used for the use, and in the textbook I decided to look into how Moles and Dogs are related with homologous traits.  Moles are mostly known for living underground in tunnels all over Europe, Asia, and South Africa.  They are small mammals with over twenty different species, most found on land but some are semi-aquatic.  They are apart of the Insectivora family.  Dogs are classified under Carnivora because of their special classifications that would make them applicable to be a predator.  They have forward facing eyes and large front teeth called canines.  Although they are classified under Carnivora they are much more omnivorous when it comes down to their actually eating habits which is quite similar to that of the Mole.  The homologous trait among these two mammals is their tetrapod limbs, they both have four limbs with the same bone structure, but the limbs are differently shaped.  Their limbs also carry out different functions.  The main function Moles use their limbs for is to burrow down into the earth with their little claws.  Dogs use their limbs to run, dig, and stabilize themselves.  Both species are mammals but their main ancestors are those from the Eutheria species.

Analogous Traits
In the text "Introduction to Physical Anthropology" on page 110 in chapter five it states that analogous traits are those that are "due to a common environmental pressure that caused both species to develop a similar adaption to that stress."  This mechanism is known as parallel evolution.  Bats and Butterflies both have wings but are not related directly.  Bats are a mostly insect eating mammal that sometimes eat small mammals, fish, birds, or reptiles that are found all over the world.  They are the only mammal that can truly fly.  Their wings are fingers that have been elongated significantly.  A butterfly goes through a metamorphosis to produce it's wings to become a beautifully colored flying insect.  There are many different species of butterflies that all vary in color and pattern on the two sets of wings they possess.  The analogous trait that these two species share in common is that of wings and being able to fly.  Their wings give them the ability to travel from place to place easily especially in times of threat.  The common ancestor of these species did not share the trait of having wings and being able to fly.  Butterflies are protostomes and bats are deuterostomes.

Bibliography

"Basic Facts About Bats." Bats. N.p., n.d. Web. 19 Jan. 2015.

"Basic Facts About Butterflies." Butterflies. N.p., n.d. Web. 19 Jan. 2015.

"Carnivora (Bears, Dogs, Cats, Seals and Allies) and Families | Skulls Unlimited International, Inc. 1-800-659-SKULL." Bears, Dogs, Cats, Seals and Allies (Carnivora): Skulls and Skeletons by Order. N.p., n.d. Web. 19 Jan. 2015.

"Evidence of Evolution: Homology Sometimes a Discussion of Evolution Needs to Consider How Evolution Does NOT Happen." BIL 160. N.p., n.d. Web. 19 Jan. 2015.

Kilgore, Lynn, Wenda Trevathan, and Russell L. Ciochon. "Chapter 5." Introduction to Physical Anthropology. By Robert Jurmain. Australia: Wadsworth, 2013. N. pag. Print."Mole." (Talpidae). N.p., n.d. Web. 19 Jan. 2015

Williams, S. B., A. M. Wilson, J. Daynes, K. Peckham, and R. C. Payne. "Functional Anatomy and Muscle Moment Arms of the Thoracic Limb of an Elite Sprinting Athlete: The Racing Greyhound (Canis Familiaris)." Journal of Anatomy. Blackwell Science Inc, 24 July 2008. Web. 19 Jan. 2015.

Protein Synthesis

TTCGTACTAAGTCTGAAGTGGATTTAAATTGTGTGCATCAATCAATA

When it comes to Charles Darwin’s theory of Natural Selection, Thomas Malthus, an English economist had the greatest positive influence on it.  Strangely enough, Malthus was not interested in science or the change of species what so ever, he wrote his paper “An Essay on the Principle of Population” to argue for a limit to human population growth.  Although his essay contributed greatly to the contemporary system of economics, he made a huge influence in the world of science and biology.  If Malthus never made an argument towards limiting human population growth Darwin would have never found the most crucial key to his idea of Natural Selection, competition.  

The competition among individuals was extremely important to Malthus because he believed that even though human population was increasing the resources were staying the same.  With this belief he made the assumption that a lack of sufficient food and water would make humans deal with a lifetime of misery and famine.  Malthus said, “…if not for natural controls such as famine and disease…” the size of human population would increase immensely.(http://www.pbs.org/wgbh/evolution/library/02/5/l_025_01.html)  This assertion was the most influence on Darwin because he used it towards all organisms, not just humans.  Competition or what Darwin saw as the “struggle for existence” was the biggest component to his theory of Natural Selection which has come to be the key to evolution theory.

The point stating “All organisms have the potential of reproducing exponentially.” was influenced by Thomas Malthus because he wrote in “An Essay on the Principle of Population” about how vast the human population was becoming during his lifetime and this influenced Darwin to look at how often and how many offspring organisms reproduce and question why all of the offspring do not survive into adulthood.  “Resources are limited.” is a huge point when looking at Malthus’ contribution to Darwin because it is the true answer as to what I had said earlier.  The fact that there are so many limited necessary resources for survival cause many offspring from a species to die off, which leads even more into the entire theory of Natural Selection.  Thanks to Thomas Malthus, Natural Selection became Charles Darwin’s greatest work.  Darwin used Malthus’ assertions as a basis to his research on all organisms, that is why Natural Selection would have never been a reality without the wisdom of Thomas Malthus.

During the time of Darwin's findings on Natural Selection the church saw the work very opposing to what they believed in.  He was afraid to insult his wife as well because of her strong association and belief in the church.  Alfred Russel Wallace lead Darwin to finally publish his book "On the Origins of Species" because he was the original finder of the theory of Natural Selection.  Although the topic was extremely controversial, the liberal Anglicans believed his theory was all apart of God's work.

Being Stranded on a Desert Island...

No one ever thinks about being stranded on a desert island until asked.  It is a difficult task to decide what is really needed in this situation and what is not.  If I were to end up in this situation I would bring a knife with me and a survival guide book.  A knife is always a good thing to have because it is useful in so many ways.  It can be used to kill, to create things, and for one's own safety.  A survival guide book would be useful because there are so many different things that can be done with the vast majority of nature's creations.  If the situation were to actually arise I'm not completely sure if I would actually think of these or if I would end up choosing completely useless items.